WEEKS 14 & 15 Virtual Screening: Positive and Negative Controls
Table 1: GOLD Scores for control compounds.
Figure 1: GOLD docking of positive control CID1314754 into the active site of 3N28. 3N28 shown as surface with carbons colored green, and CID1314754 shown as sticks with carbons colored yellow.
Figure 2: GOLD docking of negative control CID707769 into the active site of 3N28. 3N28 shown as surface with carbons colored green, and CID707769 shown as sticks with carbons colored yellow.
The control compounds did not generate the scores expected - many of the negative controls actually scored higher than the positive controls. This is not too unexpected, however, because the positive controls were not chosen specifically for my protein 3N28 but rather for the homologous protein 1L7P. Since there is very limited literature about 3N28, there was no evidence on which to base selection of the negative controls, so they were just chosen randomly. There are more like novel compounds than real negative controls, because there is no evidence that any of them do NOT interact with phosphoserine phosphatase.
Virtual Screening: Novel Compounds
Table 1: Top 10 GOLD-Ranking Novel Ligands in 3N28, sorted by GOLD Score. Ligand SAM001246581 is highlighted in yellow because it is the ligand that will be ordered for wet lab assays.
Figure 1: (Left) GOLD docking of novel ligand SAM001246581 into the active site of 3N28. 3N28 shown as surface with carbons colored green, and SAM001246581shown as sticks with carbons colored yellow. (Right) 2D Schematic of 3rd best GOLD-scoring ligand SAM001246581 with corresponding Lipinski’s data.
The best novel compound, SAM001246577, generated a GOLD score of 82.66 but did not satisfy Lipinski's Rule. The best novel compound that did satisfy Lipinski's Rule was the third highest-scoring compound, SAM001245681, which generated a GOLD score of 77.06. This compound is from the NIH Compound Library. A score of 77.06 is actually not a great GOLD score - this compound will still be ordered for wet lab inhibition assays, but screening of additional libraries will also be employed in an attempt to identify compounds that generate higher GOLD scores. It would also be a good idea to screen the same libraries with another docking program, like ICM or AutoDock, because if compounds generate high scores in two programs then they are more likely to perform well in assays.
12042014- Never did fix that formating, but great job with everything else WEEKS 11, 12, & 13
Virtual Screening: Positive and Negative Controls
Virtual Screening: Determining the Active Site
Virtual screening requires that the active site of the protein be identified, but in our case this proved to be a little bit difficult because our PDB structure does not have a ligand that can be used to identify the active site. This issue was combatted by aligning our protein with a homologous protein (PDB ID 1L7P) from Methanocaldococcus jannaschii. This yielded a decent RMS value of 1.8 - this is higher than is normally acceptable because our structure is larger than the homologous protein (evident in the green section on the right side of Figure 1), but because the active sites are very similar it is okay. Figure 2 shows a close-up of this alignment at the active site with 1L7P's ligand, SEP (phosphoserine). This alignment was used simply to identify which 3N28 pocket contained the active site. Once this was determined, a dummy ligand (cyclopentadiene) was inserted into the active site pocket of 3N28 using PyMol. Then, the active site was simply defined as containing all residues within 5 Angstroms of the dummy ligand. The modified 3N28 structure that contains the dummy ligand is shown in Figure 3, and this is the structure that will be used in virtual screening.
Trouble Shooting Failed Cloning Attempt: Re-Cutting pNIC and Gel Extraction
I have not yet completed the gel extraction protocol - I will update here when I do. What I've done so far is run my PCR-squared product on two different gels, and cut the bands out of the gel. The bands are currently being stored in the -20 degree Celsius freezer. For PCR-squared, I doubled the volumes of all the components added so that I ended up with a total of 8 50uL tubes of product rather than only 4 tubes. This is because a lot of the product is lost during the gel extraction process, so it's necessary to start with a lot of extra product. I ran 4 tubes on each gel.
I also cut new pNIC, as shown in FIgure 2, but I'll have to do it again. I did this RE Digest before I realized that I should not see a third band (I should see only the cut vector and the SacB gene that was cut out). The third band is uncut pNIC and indicates that not all of the vector is being cut. To rectify this in the next RE digest, the pNIC and BsaI-HF will be left in the water bath for a full three hours instead of 2.5 and more restriction enzyme will be added.
Cloning Attempt 1
The first attempt at cloning was unsuccessful - after 36 hours of incubation there was no growth on the either plate (height the one with the 2:4 ration of vector to insert nor the plate with the 2:8 ratio). The lack of growth could be contributed to many factors. First of all, the pNIC below was not cut well - three bands should actually not be visible, as there should be no uncut pNIC left. Abundance of uncut pNIC would mean that a lot of the vector being taken up into the cells would be the full pNIC vector containing the SacB gene and not the vcPSP inset, so when they are plated on the sucrose plate they do not survive because of the presence of the SacB gene. To rectify this, before future cloning attempts are made more pNIC will be cut - it will be submerged in the water bath for a full 3 hours (instead of 2.5 as was done before) allowing BsaI-HF to cut for as long as possible, and more BsaI-HF will be added to ensure that all the pNIC present is cut. Also, there was a lot of contamination in the initial PCR-squared product used in the first cloning attempt. To eliminate this extensive contamination, PCR-squared will be repeated and the product will undergo gel extraction to further purify the CDS before being used in cloning. Finally, different ratios of accepting vector to insert will be experimented with, with a focus on significantly increasing the amount of insert present.
1162014- Good job, just work on your formatting WEEKS 8, 9, & 10 Restriction Enzyme Digest of pNIC Plasmid
Figure 1: Product of pNIC digestion by restriction enzyme BsaI-HF run on a 1.2% Agarose gel for ~40 minutes at 120V.Lane 2: 1kb ladderLane 4: 6uL digest pNIC plasmid + 2uL Blue JuiceAll other lanes are empty.
The pNIC plasmid was digested by the restriction enzyme BsaI-HF, which cuts the plasmid in two places thus removing a chunk of the plasmid that contains the SacB gene. Removal of the SacB gene will be very important later in the cloning process to select for bacteria that have picked up the plasmid containing the gene of interest rather than the uncut plasmid. BsaI-HF cuts so that it leaves sticky ends of the open edges of the plasmid - these sticky ends are complementary to the custom tail primer sticky ends on the CDS and will serve to allow the CDS to be inserted into the pNIC vector. Looking at the gel, the pNIC plasmid looks like it was cut correctly. The heaviest band is the uncut plasmid - pNIC vector that was not cut by Bsa-HF. The middle band is the pNIC vector from which the SacB gene was removed - it is slightly smaller/lighter than the uncut plasmid because it is missing only the SacB gene. And the lightest band is the SacB gene that was removed from the pNIC plasmid - it is significantly lighter than both the uncut plasmid and the part of the plasmid from which it came. Now that the pNIC vector has been cut, the next step is to insert the vcPSP CDS into the cut plasmid, and then transform DH5-alpha competent cells with the plasmid containing the CDS.
PCR-Cleanup
Figure 1: Nanodrop analysis to determine [gene product] after PCR cleanup on the vcPSP gene showing the concentration of the product to be 59.5 ng/uL. 260/280 value is 1.79 and 260/230 value is 3.08. Peak wavelength ~260nm.
The purpose of PCR-Cleanup is to purify the gene of interest and remove other contamination and DNA fragments. How effectively this is done can be analyzed using the 260/280 and 260/230 NanoDrop values. My 260/280 value was exactly where it was supposed to be, near 1.8 (mine was 1.79) - this indicates that almost everything in solution is DNA and not contaminated by proteins. However my 260/230 value, which should be close to 2.1, was very high at 3.1 and indicates a significant amount of contamination. But despite this evidence of contamination and a relatively low yield (a "normal" concentration would have been closer to 100 ng/uL), I decided to move forward and begin trying to insert the vcPSP CDS into the pNIC plasmid and transform it into DH5-alpha competent cells. If the contamination is significant, it will be determined after cloning in comparing the DNA sequence of the clone to what it should be. If the contamination is not significant I will ultimately get a positive clone despite the contamination, but if I only get negative clones then contamination would be a possible explanation.
PCR-Squared
Figure 1: PCR2 product for vcPSP run on a 1.2% agarose gel for ~40 minutes at 120V.Lane 2: 1kb ladderLane 4: 10uL PCR2-1 vcPSP product + 2uL Blue JuiceLane 5: 10uL PCR2-2 vcPSP product + 2uL Blue JuiceLane 6: 10uL PCR2-3 vcPSP product + 2uL Blue JuiceLane 7: 10uL PCR2-4 vcPSP product + 2uL Blue JuiceAll other lanes are empty.
As indicated by the distinct bands in Lanes 4-7 near the 1kb ladder in Lane 2, PCR-Squared was successful and amplified the vcPSP CDSin all four trials. The band looks like it is indeed the gene of interest because of its position relative to the 1kb mark on the ladder - since the vcPSP CDS is 987bp, it was expected that the CDS amplified in PCR-Squared would be very close to the 1kb band on the ladder, and indeed it is. There is still a good amount of contamination in all of the samples, indicated by the smears surrounding the distinct bands. This is disconcerting and more contamination that I would've liked to see, but since I do have distinct bands only near the size of my gene of interest, I decided to move forward and proceed to PCR-Cleanup with the hope that the contamination would be removed during that process.
Secondary PCR
Figure 1: Secondary PCR vcPSP CDS product run on a 1.2% Agarose gel for ~40 minutes at 120V.Lane 2: 1kb ladderLane 4: Kenan's Secondary PCR Product, vcPSPLane 6: 10uL my Secondary PCR Product + 2uL Blue JuiceAll other lanes are empty.
Secondary PCR was successful, as indicated by the single dark band in Lane 6 on Figure 1. Looking at the 1kb ladder in Lane 2, the second band from the bottom corresponds to 1kb. In row 6, my secondary PCR product is near that same level, which is a good sign because the vcPSP CDS is 987 base pairs so it was expected that it be near the 1kb ladder band. The intensity/darkness of the band also looks really good, meaning there is a lot of product (as opposed to Kenan's band in Lane 4, which has a very low intensity). There is a good amount of contamination in my sample, indicated by the smear surrounding the isolated band in Lane 6 - hopefully the concentration of this contamination in relation to the CDS will be lessened in PCR-squared and then removed in PCR-cleanup.
10232014- Good job WEEKS 5, 6, & 7 Tail Primer Design The tail primers we designed and ordered are listed below. These are the second round of tail primers we ordered, as the first forward primer was too long and would not work at the same temperature as a reverse primer, and the first reverse primer was not completely reverse complemented (there was probably some error in copying-and-pasting the sequence during the design process) so it would not have bound to the pNIC plasmid. This first set of primers was thrown away, and the second set (listed below) were ordered - next week they will be diluted and then used for secondary PCR.
Forward Primer: 5’ TAC TTC CAA TCC ATG TCT CTG GAC GCG 3’ 27 bp GC Content 51.9% 0.0 mM Mg2+ Tm 62.3 oC 1.5 mM Mg2+ Tm 68.8 oC 2.0 mM Mg2+ Tm 69.3 oC 4.0 mM Mg2+ Tm 70.4 oC 6.0 mM Mg2+ Tm 70.9 oC
Reverse Primer: 5’ TAT CCA CCT TTA CTG TTA CGG TTT AGA TTT CCA GCT 3’ 36 bp GC Content 38.9% 0.0 mM Mg2+ Tm 61.8 oC 1.5 mM Mg2+ Tm 69.5 oC 2.0 mM Mg2+ Tm 70.0 oC 4.0 mM Mg2+ Tm 71.0 oC 6.0 mM Mg2+ Tm 71.5 oC
Primary PCR
Figure 1: UV Image of vcPSP oligo mix after primary PCR on 1.2% agarose gel after being run at 115V for approximately 40 minutes. Arrow pointing the 1kb band on the ladder.Lane 1: EmptyLane 2: 1 kb ladderLane 3: Oligo mix after primary PCRLane 4: EmptyLane 5: EmptyLane 6: Empty
Primary PCR was a success! The sample was run in Lane 3, and the smear is exactly what I had hoped to see. During primary PCR the oligos are assembled into fragments of the complete gene - some of the pieces are the full gene, but there are also some fragments that are bigger and smaller than the full gene. Since there are lots of pieces of different sizes, you see a smear. Typically the middle of the smear is about where you'd expect the size of your gene to be, and in the gel above, that's the case.The Phosphoserine Phosphatase gene in Vibrio cholerae is 987 base pairs, and the middle of the smear is at roughly 1000 base pairsaccording to the ladder - this is a good sign. The next step is to do secondary PCR, and then PCR2. After that, I can start trying to cut the pNIC plasmid and insert my gene into it.
Midi-Prep The purpose of Midi-Prep is to isolate the pNIC plasmid from the transformed DH5-alpha cells. In Weeks 3 and 4, DH5-alpha cells were transformed with the pNIC plasmid, cultured on a plate, and then cultured overnight in a liquid solution. That solution was spun down in the centrifuge, and the cell pellet was frozen. That frozen cell pellet was used in this Midi-Prep procedure. It was resuspended and exposed to various buffers and filters as per the Midi-Prep protocol, and ultimately the vector was isolated from the rest of the cell's components (membrane debris, proteins, other DNA, etc). After isolating the vector, NanoDrop analysis was performed to determined the concentration of plasmid in the resulting solution. Figure 1 below shows the three trials of NanoDrop done to determine an average concentration of 148.6 ng/uL.
Figure 1: (left) First NanoDrop trial, (middle), second NanoDrop trial, and (right) third NanoDrop trial to determine the concentration of the pNIC vector after Midi-Prep.
This is rather high considering that pNIC is a low-copy plasmid - an average yield is somewhere between 40 and 60 ng/uL. We believe this is because we used a much larger cell pellet than is typically used (typically the 160mL liquid culture from the overnight transformation is separated into four cell pellets and each pellet is subjected to Midi-prep, but we only made one cell pellet from the whole culture). However, before starting cloning we will most likely send a sample off to be sequenced to make sure that there was no contamination and that what we isolated is indeed uncontaminated pNIC.
Oligo Primer Design The 24 primers listed below were ordered and used to make an oligo mix. Making the oligo mix is a process very susceptible to contamination, so maintaining a sterile environment is crucial during this process. If there is contamination and DNA other than the sequence of the oligo primers is introduced into the mix, that DNA sequence will be amplified during PCR with the other oligos and the gene ultimately synthesized will not have the correct sequence. To prevent contamination, it was important to avoid sneezing, coughing, or even breathing onto the box containing the oligos. When the lid was off, a Kimwipe was placed over all the wells except the one that was currently in use to prevent contamination from the air getting into the wells. All work was done by a bunsen burner, and pipette tips were changed between every well. We know that the oligo mix worked only in that primary PCR worked (it amplified something), but we won't know if there was any contamination in the mix until the gene is actually sequenced after cloning. 1 ATGTCTCTCGATGCGCTGACCACCCTCCCGATCAAAAAACACACCGCACTGCTGAACCG 59 2 CACGCTTCTTCGCGAGCTGGGTAACGAAACGAGTCTCTGGGAAGCGGTTCAGCAGTGCGG 60 3 GCTCGCGAAGAAGCGTGCGTCTTGGATTGTTTTCGGTCACTATCTCACTCCGGCGCAGTT 60 4 GAGGATCGCGTTAAAACGATTGGTGAAAAAGTCCATATCTTCGAACTGCGCCGGAGTGAG 60 5 AATCGTTTTAACGCGATCCTCGATATGTGGAAAGTTGGCCGTTACGAGGTGGCCCTGATG 60 6 GCGCTTTCAGGATGGTTTCGTGTTCAGACGTCAGTTCACCGTCCATCAGGGCCACCTCGT 60 7 GAAACCATCCTGAAAGCGCTGGAACTGGATTATGCGCGTATCCAGGACGTTCCGGACCTG 60 8 TCGCGGTAGAGTCCATGTCCAGCACGATCAGGCCCGGTTTAGTCAGGTCCGGAACGTCCT 60 9 ACATGGACTCTACCGCGATTCAGATCGAATGCATCGACGAAATCGCGAAACTGGCGGGTG 60 10 ACCTTGCATGGCACGCTCGGTGACTTCCGCAACCTCCTCGCCAACACCCGCCAGTTTCGC 60 11 GCGTGCCATGCAAGGTGAGCTGGATTTTGAACAGTCTCTCCGCCTCCGCGTGTCTAAGCT 60 12 GTTTCACGAACCTGGCTCAGGATCTGTTCTGGCGCGTCTTTGAGCTTAGACACGCGGAGG 60 13 TGAGCCAGGTTCGTGAAACCCTGCCGCTCATGCCGGAACTGCCGGAGCTCGTTGCTACTC 60 14 AGCCACCAGAGGCGATGGCAACCTTCCAACCGAACGCGTGCAGAGTAGCAACGAGCTCCG 60 15 CATCGCCTCTGGTGGCTTCACCTACTTCTCTGACTACCTGAAGGAACAGCTCTCTCTGGA 60 16 TTTACCAGAAACGATCTCCAGGGTGTTAGACTGCGCATAGTCCAGAGAGAGCTGTTCCTT 60 17 CCTGGAGATCGTTTCTGGTAAACTGACTGGTCAGGTGCTGGGTGAAGTTGTTTCCGCGCA 60 18 TCGTACTGCTGCGCCAGGGTCAGGAGGATGTCCGCTTTGGTCTGCGCGGAAACAACTTCA 60 19 TGGCGCAGCAGTACGATGTTGAAATCCACAACACCGTTGCGGTAGGCGACGGTGCGAACG 60 20 CGTGGTACGCAACGCCGAGGCCGGCTGCTGCCATCATAACCAGGTCGTTCGCACCGTCGC 60 21 GGCGTTGCGTACCACGCCAAGCCGAAAGTAGAAGCGAAGGCGCAAACGGCGGTACGCTTC 60 22 CGAGGGCCGCAGACAGGATGCAAACCACACCACCGAGACCAGCGAAGCGTACCGCCGTTT 60 23 CTGTCTGCGGCCCTCGTAGCGCAACAAAAACTCAGCTGGAAATCTAAAGAGGGTCATCAC 60 24 TTAATGATGATGGTGGTGATGACCCTCTTTAGATTTCC 38
Figure 1: Simulation of expected results on an agarose gel after the restriction enzyme digest, obtained from the "Analyzing DNA Sequence" exercise. EcoRI has one restriction site on the pGBR-22 plasmid, so it is expected to see only one large and "heavy" piece of plasmid on the gel. PvuII has two restriction sites, so it is expected to see two pieces of plasmid on the gel. When using both EcoRI and PvuII there is a combined total of three restriction sites, so it is expected to see three pieces of plasmid on the gel.
Figure 2: UV image of the 1% agarose gel after being run for approximately 40 minutes. Lane 1: Empty Lane 2: 1kb DNA Ladder Lane 3: Uncut pGBR-22 plasmid Lane 4: pGBR-22 plasmid cut with EcoRI Lane 5: pGBR-22 plasmid cut with PvuII Lane 6: pGBR-22 plasmid cut with EcoRI and PvuII Lanes 7-10: Empty
The results on the gel are only partially what was expected. In lane 3 there should be one mark for the uncut pGBR-22 plasmid, but there is nothing visible in that lane. Lane 4 looks perfect - there is one mark corresponding to the one piece of linear DNA obtained when the pGBR-22 plasmid is cut by EcoRI at one restriction site. Additionally, since the plasmid in Lane 4 is still the entire plasmid just in linear form, it makes sense that the piece is larger and has not moved as far down the gel as the smaller plasmid pieces in Lanes 5 and 6. Lane 5 looks okay - there should be two marks in the lane since PvuII cuts the plasmid in two places, resulting in two smaller pieces of DNA. The first mark is very clear, and the second mark is barely visible (but present) at the bottom of the lane - ideally, though, the two marks should have the same level of clarity. Lane 6 is not at all what it should be - there should be three marks corresponding to the three pieces of plasmid, but only one mark is visible. Because Lane 4 looks so good, it is likely that the problem here was in running the gel rather than with the RE digest itself. There were several problems with running the gel. First of all, the mold in which the gel was made was broken, so it's possible that the wells in the gel were not straight. Secondly, the only top available for use at the time the gel was run was broken - the current kept turning on and off, which obviously would've affected the results seen the gel.
Transformation of DH5-Alpha Cells (Days 2 and 3)
Figure 3: 160mL LB + pNIC-Bsa4 +Kan after ~14 hours in the shaking incubator at 37 degrees Celsius. Solution is murky as is expected with bacterial growth - the transformed bacteria seem to have grown well overnight. It is important to note that for this portion of this experiment I did not use my own transformed pNIC-Bsa4 cells - my transformation (as shown below) did not work in time for me to use the bacteria for this experiment. Instead, I used a colony of Stacey's cells from her agar plate that initially had 50 microliters of bacteria. After removing my solution from the incubator in the morning and preparing it for centrifuging (shown in Figure 3), I had to go to class. Melissa put the solution in the centrifuge for me, spun it down, and then stored the pellet in the -20 degree Celsius freezer.
My First PCR
Figure 2: UV image of the 1.3% agarose gel after being run for approximately 40 minutes at 105V. Lane 1: 100 bp DNA Ladder Lane 2: Tube A - 0.3 ng pGBR-22 DNA Lane 3: Tube B - 3.0 ng pGBR-22 DNA Lane 4: Tube C - 30 ng pGBR-22 DNA Lane 5: Tube D - no template pGBR-22 DNA Lane 6: Empty
The results are as expected, so it can be confided that PCR on pGBR-22 was successful! The 100 bp ladder in Lane 1 looks strange (most likely because of the gel "smiling"), but the other lanes look great. The amount of template DNA in each tube was increased by a factor of ten each time (0.3 ng DNA in Tube A t0 3 ng DNA in Tube B to 30 ng DNA in Tube C), so it was expected that after PCR the gel would reveal an increasing concentration from Row 2 (Tube A) to Row 3 (Tube B) to Row 4 (Tube C). This is exactly what the gel shows. Additionally, Row 5 serves as a control because there was no template DNA added to Tube D. As expected, we see nothing in Row 5. WEEKS 1 & 2 NanoDrop/DNA Sequencing
Figure 1: NanoDrop results from the pGBR-22 sample, showing the concentration of the protein to be 22.5 ng/uL. The absorbance peak is around 260nm, as is expected for a protein. However, the purity ratios (260/280 and 230/280) are both higher than they should be.
Figure 2: Forward sequence of the pGBR-22 sequence, as obtained from the DNA Sequencing Core at UT Austin. Order Number 106937. N's stand in place of amino acids whose identities were not able to be determined.
Figure 3: Reverse sequence of the pGBR-22 sequence, as obtained from the DNA Sequencing Core at UT Austin. Order Number 106937. N's stand in place of amino acids whose identities were not able to be determined.
Analyzing DNA Sequence Exercise
Figure 1: NCBI BLAST of the M13R Primer Sequence against the human genome looking for 'somewhat similar' sequences. The closest match to the primer sequence is part of the human X chromosome, which shares 97% identity but only 5% query cover with the M13R sequence.
Figure 2: NCBI BLAST of the M13R Primer Sequence against all genomes looking for 'somewhat similar' sequences. The closest match to the primer sequence is Montipora efflorescens GFP-like chromoprotein, which shares 100% identity and 60% query cover with the M13R sequence.
Figure 3: Complete sequence of pGBR-22. Obtained by taking the vector pGemT sequence, matching it up with the M13R sequence by identifying flanking regions, and inserting the corresponding part of the M13R sequence in between the left (highlighted grey) and right (highlighted pink) flanking regions. The start codon, ATG, is highlighted green. The Shine-Dalgarno region, AGGAGA, is highlighted cyan. The stop codon, TAA, is highlighted red. And, the part of the M13R sequence that was inserted is bolded and underlined.
Transformation of DH5-Alpha Cells
Figure 1: Agar plate with 10uL DH5-alpha cells with pNIC-Bsa4 plasmid after ~16 hours in the 37 degree Celsius incubator. No growth is evident.
Figure 2: Agar plate with 50uL DH5-alpha cells with pNIC-Bsa4 plasmid after ~16 hours in the 37 degree Celsius incubator. No growth is evident.
As is obvious from the images above, the transformation did not work and there was no growth on the plates. This could be attributed to any one of many different errors. The DH5-alpha cells were not used within five minutes of being removed from the freezer - it is possible that they died and were no longer competent before the rest of the experiment was even started. If they did survive, they were also left on ice for an hour rather than thirty minutes because we forgot to heat the hot water bath beforehand and had to wait an additional thirty minutes for the water to warm up for the heat shock. Finally, after heat shocking and adding SOC media the cells remained in the shaking incubator for longer than thirty minutes because we had forgotten to warm up the agar plats in the incubator beforehand so had to wait for them to warm up before plating the bacteria. Regardless of where the mistake happened, the experiment will be repeated next week. *UPDATE* I repeated the transformation process, but was silly and used the wrong plasmid. I used pGBR-22 instead of pNIC because we had been working so much with pGBR-22 that week that I got confused. I'm confident that in the future (if I remember to use the correct plasmid) my transformations will be successful because repeating the experiment made me very familiar with the protocol even though it didn't actually work.
WEEKS 14 & 15
Virtual Screening: Positive and Negative Controls
The control compounds did not generate the scores expected - many of the negative controls actually scored higher than the positive controls. This is not too unexpected, however, because the positive controls were not chosen specifically for my protein 3N28 but rather for the homologous protein 1L7P. Since there is very limited literature about 3N28, there was no evidence on which to base selection of the negative controls, so they were just chosen randomly. There are more like novel compounds than real negative controls, because there is no evidence that any of them do NOT interact with phosphoserine phosphatase.
Virtual Screening: Novel Compounds
The best novel compound, SAM001246577, generated a GOLD score of 82.66 but did not satisfy Lipinski's Rule. The best novel compound that did satisfy Lipinski's Rule was the third highest-scoring compound, SAM001245681, which generated a GOLD score of 77.06. This compound is from the NIH Compound Library. A score of 77.06 is actually not a great GOLD score - this compound will still be ordered for wet lab inhibition assays, but screening of additional libraries will also be employed in an attempt to identify compounds that generate higher GOLD scores. It would also be a good idea to screen the same libraries with another docking program, like ICM or AutoDock, because if compounds generate high scores in two programs then they are more likely to perform well in assays.
12042014- Never did fix that formating, but great job with everything else
WEEKS 11, 12, & 13
Virtual Screening: Positive and Negative Controls
Virtual Screening: Determining the Active Site
Trouble Shooting Failed Cloning Attempt: Re-Cutting pNIC and Gel Extraction
I have not yet completed the gel extraction protocol - I will update here when I do. What I've done so far is run my PCR-squared product on two different gels, and cut the bands out of the gel. The bands are currently being stored in the -20 degree Celsius freezer. For PCR-squared, I doubled the volumes of all the components added so that I ended up with a total of 8 50uL tubes of product rather than only 4 tubes. This is because a lot of the product is lost during the gel extraction process, so it's necessary to start with a lot of extra product. I ran 4 tubes on each gel.
I also cut new pNIC, as shown in FIgure 2, but I'll have to do it again. I did this RE Digest before I realized that I should not see a third band (I should see only the cut vector and the SacB gene that was cut out). The third band is uncut pNIC and indicates that not all of the vector is being cut. To rectify this in the next RE digest, the pNIC and BsaI-HF will be left in the water bath for a full three hours instead of 2.5 and more restriction enzyme will be added.
Cloning Attempt 1
The first attempt at cloning was unsuccessful - after 36 hours of incubation there was no growth on the either plate (height the one with the 2:4 ration of vector to insert nor the plate with the 2:8 ratio). The lack of growth could be contributed to many factors. First of all, the pNIC below was not cut well - three bands should actually not be visible, as there should be no uncut pNIC left. Abundance of uncut pNIC would mean that a lot of the vector being taken up into the cells would be the full pNIC vector containing the SacB gene and not the vcPSP inset, so when they are plated on the sucrose plate they do not survive because of the presence of the SacB gene. To rectify this, before future cloning attempts are made more pNIC will be cut - it will be submerged in the water bath for a full 3 hours (instead of 2.5 as was done before) allowing BsaI-HF to cut for as long as possible, and more BsaI-HF will be added to ensure that all the pNIC present is cut. Also, there was a lot of contamination in the initial PCR-squared product used in the first cloning attempt. To eliminate this extensive contamination, PCR-squared will be repeated and the product will undergo gel extraction to further purify the CDS before being used in cloning. Finally, different ratios of accepting vector to insert will be experimented with, with a focus on significantly increasing the amount of insert present.
1162014- Good job, just work on your formatting
WEEKS 8, 9, & 10
Restriction Enzyme Digest of pNIC Plasmid
The pNIC plasmid was digested by the restriction enzyme BsaI-HF, which cuts the plasmid in two places thus removing a chunk of the plasmid that contains the SacB gene. Removal of the SacB gene will be very important later in the cloning process to select for bacteria that have picked up the plasmid containing the gene of interest rather than the uncut plasmid. BsaI-HF cuts so that it leaves sticky ends of the open edges of the plasmid - these sticky ends are complementary to the custom tail primer sticky ends on the CDS and will serve to allow the CDS to be inserted into the pNIC vector. Looking at the gel, the pNIC plasmid looks like it was cut correctly. The heaviest band is the uncut plasmid - pNIC vector that was not cut by Bsa-HF. The middle band is the pNIC vector from which the SacB gene was removed - it is slightly smaller/lighter than the uncut plasmid because it is missing only the SacB gene. And the lightest band is the SacB gene that was removed from the pNIC plasmid - it is significantly lighter than both the uncut plasmid and the part of the plasmid from which it came. Now that the pNIC vector has been cut, the next step is to insert the vcPSP CDS into the cut plasmid, and then transform DH5-alpha competent cells with the plasmid containing the CDS.
PCR-Cleanup
The purpose of PCR-Cleanup is to purify the gene of interest and remove other contamination and DNA fragments. How effectively this is done can be analyzed using the 260/280 and 260/230 NanoDrop values. My 260/280 value was exactly where it was supposed to be, near 1.8 (mine was 1.79) - this indicates that almost everything in solution is DNA and not contaminated by proteins. However my 260/230 value, which should be close to 2.1, was very high at 3.1 and indicates a significant amount of contamination. But despite this evidence of contamination and a relatively low yield (a "normal" concentration would have been closer to 100 ng/uL), I decided to move forward and begin trying to insert the vcPSP CDS into the pNIC plasmid and transform it into DH5-alpha competent cells. If the contamination is significant, it will be determined after cloning in comparing the DNA sequence of the clone to what it should be. If the contamination is not significant I will ultimately get a positive clone despite the contamination, but if I only get negative clones then contamination would be a possible explanation.
PCR-Squared
As indicated by the distinct bands in Lanes 4-7 near the 1kb ladder in Lane 2, PCR-Squared was successful and amplified the vcPSP CDS in all four trials. The band looks like it is indeed the gene of interest because of its position relative to the 1kb mark on the ladder - since the vcPSP CDS is 987bp, it was expected that the CDS amplified in PCR-Squared would be very close to the 1kb band on the ladder, and indeed it is. There is still a good amount of contamination in all of the samples, indicated by the smears surrounding the distinct bands. This is disconcerting and more contamination that I would've liked to see, but since I do have distinct bands only near the size of my gene of interest, I decided to move forward and proceed to PCR-Cleanup with the hope that the contamination would be removed during that process.
Secondary PCR
Secondary PCR was successful, as indicated by the single dark band in Lane 6 on Figure 1. Looking at the 1kb ladder in Lane 2, the second band from the bottom corresponds to 1kb. In row 6, my secondary PCR product is near that same level, which is a good sign because the vcPSP CDS is 987 base pairs so it was expected that it be near the 1kb ladder band. The intensity/darkness of the band also looks really good, meaning there is a lot of product (as opposed to Kenan's band in Lane 4, which has a very low intensity). There is a good amount of contamination in my sample, indicated by the smear surrounding the isolated band in Lane 6 - hopefully the concentration of this contamination in relation to the CDS will be lessened in PCR-squared and then removed in PCR-cleanup.
10232014- Good job
WEEKS 5, 6, & 7
Tail Primer Design
The tail primers we designed and ordered are listed below. These are the second round of tail primers we ordered, as the first forward primer was too long and would not work at the same temperature as a reverse primer, and the first reverse primer was not completely reverse complemented (there was probably some error in copying-and-pasting the sequence during the design process) so it would not have bound to the pNIC plasmid. This first set of primers was thrown away, and the second set (listed below) were ordered - next week they will be diluted and then used for secondary PCR.
Forward Primer:
5’ TAC TTC CAA TCC ATG TCT CTG GAC GCG 3’ 27 bp
GC Content 51.9%
0.0 mM Mg2+ Tm 62.3 oC
1.5 mM Mg2+ Tm 68.8 oC
2.0 mM Mg2+ Tm 69.3 oC
4.0 mM Mg2+ Tm 70.4 oC
6.0 mM Mg2+ Tm 70.9 oC
Reverse Primer:
5’ TAT CCA CCT TTA CTG TTA CGG TTT AGA TTT CCA GCT 3’ 36 bp
GC Content 38.9%
0.0 mM Mg2+ Tm 61.8 oC
1.5 mM Mg2+ Tm 69.5 oC
2.0 mM Mg2+ Tm 70.0 oC
4.0 mM Mg2+ Tm 71.0 oC
6.0 mM Mg2+ Tm 71.5 oC
Primary PCR
Primary PCR was a success! The sample was run in Lane 3, and the smear is exactly what I had hoped to see. During primary PCR the oligos are assembled into fragments of the complete gene - some of the pieces are the full gene, but there are also some fragments that are bigger and smaller than the full gene. Since there are lots of pieces of different sizes, you see a smear. Typically the middle of the smear is about where you'd expect the size of your gene to be, and in the gel above, that's the case. The Phosphoserine Phosphatase gene in Vibrio cholerae is 987 base pairs, and the middle of the smear is at roughly 1000 base pairs according to the ladder - this is a good sign. The next step is to do secondary PCR, and then PCR2. After that, I can start trying to cut the pNIC plasmid and insert my gene into it.
Midi-Prep
The purpose of Midi-Prep is to isolate the pNIC plasmid from the transformed DH5-alpha cells. In Weeks 3 and 4, DH5-alpha cells were transformed with the pNIC plasmid, cultured on a plate, and then cultured overnight in a liquid solution. That solution was spun down in the centrifuge, and the cell pellet was frozen. That frozen cell pellet was used in this Midi-Prep procedure. It was resuspended and exposed to various buffers and filters as per the Midi-Prep protocol, and ultimately the vector was isolated from the rest of the cell's components (membrane debris, proteins, other DNA, etc). After isolating the vector, NanoDrop analysis was performed to determined the concentration of plasmid in the resulting solution. Figure 1 below shows the three trials of NanoDrop done to determine an average concentration of 148.6 ng/uL.
This is rather high considering that pNIC is a low-copy plasmid - an average yield is somewhere between 40 and 60 ng/uL. We believe this is because we used a much larger cell pellet than is typically used (typically the 160mL liquid culture from the overnight transformation is separated into four cell pellets and each pellet is subjected to Midi-prep, but we only made one cell pellet from the whole culture). However, before starting cloning we will most likely send a sample off to be sequenced to make sure that there was no contamination and that what we isolated is indeed uncontaminated pNIC.
Oligo Primer Design
The 24 primers listed below were ordered and used to make an oligo mix. Making the oligo mix is a process very susceptible to contamination, so maintaining a sterile environment is crucial during this process. If there is contamination and DNA other than the sequence of the oligo primers is introduced into the mix, that DNA sequence will be amplified during PCR with the other oligos and the gene ultimately synthesized will not have the correct sequence. To prevent contamination, it was important to avoid sneezing, coughing, or even breathing onto the box containing the oligos. When the lid was off, a Kimwipe was placed over all the wells except the one that was currently in use to prevent contamination from the air getting into the wells. All work was done by a bunsen burner, and pipette tips were changed between every well. We know that the oligo mix worked only in that primary PCR worked (it amplified something), but we won't know if there was any contamination in the mix until the gene is actually sequenced after cloning.
1 ATGTCTCTCGATGCGCTGACCACCCTCCCGATCAAAAAACACACCGCACTGCTGAACCG 59
2 CACGCTTCTTCGCGAGCTGGGTAACGAAACGAGTCTCTGGGAAGCGGTTCAGCAGTGCGG 60
3 GCTCGCGAAGAAGCGTGCGTCTTGGATTGTTTTCGGTCACTATCTCACTCCGGCGCAGTT 60
4 GAGGATCGCGTTAAAACGATTGGTGAAAAAGTCCATATCTTCGAACTGCGCCGGAGTGAG 60
5 AATCGTTTTAACGCGATCCTCGATATGTGGAAAGTTGGCCGTTACGAGGTGGCCCTGATG 60
6 GCGCTTTCAGGATGGTTTCGTGTTCAGACGTCAGTTCACCGTCCATCAGGGCCACCTCGT 60
7 GAAACCATCCTGAAAGCGCTGGAACTGGATTATGCGCGTATCCAGGACGTTCCGGACCTG 60
8 TCGCGGTAGAGTCCATGTCCAGCACGATCAGGCCCGGTTTAGTCAGGTCCGGAACGTCCT 60
9 ACATGGACTCTACCGCGATTCAGATCGAATGCATCGACGAAATCGCGAAACTGGCGGGTG 60
10 ACCTTGCATGGCACGCTCGGTGACTTCCGCAACCTCCTCGCCAACACCCGCCAGTTTCGC 60
11 GCGTGCCATGCAAGGTGAGCTGGATTTTGAACAGTCTCTCCGCCTCCGCGTGTCTAAGCT 60
12 GTTTCACGAACCTGGCTCAGGATCTGTTCTGGCGCGTCTTTGAGCTTAGACACGCGGAGG 60
13 TGAGCCAGGTTCGTGAAACCCTGCCGCTCATGCCGGAACTGCCGGAGCTCGTTGCTACTC 60
14 AGCCACCAGAGGCGATGGCAACCTTCCAACCGAACGCGTGCAGAGTAGCAACGAGCTCCG 60
15 CATCGCCTCTGGTGGCTTCACCTACTTCTCTGACTACCTGAAGGAACAGCTCTCTCTGGA 60
16 TTTACCAGAAACGATCTCCAGGGTGTTAGACTGCGCATAGTCCAGAGAGAGCTGTTCCTT 60
17 CCTGGAGATCGTTTCTGGTAAACTGACTGGTCAGGTGCTGGGTGAAGTTGTTTCCGCGCA 60
18 TCGTACTGCTGCGCCAGGGTCAGGAGGATGTCCGCTTTGGTCTGCGCGGAAACAACTTCA 60
19 TGGCGCAGCAGTACGATGTTGAAATCCACAACACCGTTGCGGTAGGCGACGGTGCGAACG 60
20 CGTGGTACGCAACGCCGAGGCCGGCTGCTGCCATCATAACCAGGTCGTTCGCACCGTCGC 60
21 GGCGTTGCGTACCACGCCAAGCCGAAAGTAGAAGCGAAGGCGCAAACGGCGGTACGCTTC 60
22 CGAGGGCCGCAGACAGGATGCAAACCACACCACCGAGACCAGCGAAGCGTACCGCCGTTT 60
23 CTGTCTGCGGCCCTCGTAGCGCAACAAAAACTCAGCTGGAAATCTAAAGAGGGTCATCAC 60
24 TTAATGATGATGGTGGTGATGACCCTCTTTAGATTTCC 38
Targets were assigned! My target is Phosphoserine Phosphatase in Vibrio cholerae, and my group includes myself, JohnG, KeenanW, and SamD. Here is a link to our target page with all the information about our target: http://vdsstream.wikispaces.com/Target+-+Phosphoserine+phosphatase+%28Vibrio+cholerae%29
09232014- Nice Job
WEEKS 3 & 4
Restriction Enzyme Digest
Lane 1: Empty
Lane 2: 1kb DNA Ladder
Lane 3: Uncut pGBR-22 plasmid
Lane 4: pGBR-22 plasmid cut with EcoRI
Lane 5: pGBR-22 plasmid cut with PvuII
Lane 6: pGBR-22 plasmid cut with EcoRI and PvuII
Lanes 7-10: Empty
The results on the gel are only partially what was expected. In lane 3 there should be one mark for the uncut pGBR-22 plasmid, but there is nothing visible in that lane. Lane 4 looks perfect - there is one mark corresponding to the one piece of linear DNA obtained when the pGBR-22 plasmid is cut by EcoRI at one restriction site. Additionally, since the plasmid in Lane 4 is still the entire plasmid just in linear form, it makes sense that the piece is larger and has not moved as far down the gel as the smaller plasmid pieces in Lanes 5 and 6. Lane 5 looks okay - there should be two marks in the lane since PvuII cuts the plasmid in two places, resulting in two smaller pieces of DNA. The first mark is very clear, and the second mark is barely visible (but present) at the bottom of the lane - ideally, though, the two marks should have the same level of clarity. Lane 6 is not at all what it should be - there should be three marks corresponding to the three pieces of plasmid, but only one mark is visible. Because Lane 4 looks so good, it is likely that the problem here was in running the gel rather than with the RE digest itself. There were several problems with running the gel. First of all, the mold in which the gel was made was broken, so it's possible that the wells in the gel were not straight. Secondly, the only top available for use at the time the gel was run was broken - the current kept turning on and off, which obviously would've affected the results seen the gel.
Transformation of DH5-Alpha Cells (Days 2 and 3)
It is important to note that for this portion of this experiment I did not use my own transformed pNIC-Bsa4 cells - my transformation (as shown below) did not work in time for me to use the bacteria for this experiment. Instead, I used a colony of Stacey's cells from her agar plate that initially had 50 microliters of bacteria.
After removing my solution from the incubator in the morning and preparing it for centrifuging (shown in Figure 3), I had to go to class. Melissa put the solution in the centrifuge for me, spun it down, and then stored the pellet in the -20 degree Celsius freezer.
My First PCR
Figure 2: UV image of the 1.3% agarose gel after being run for approximately 40 minutes at 105V.
Lane 1: 100 bp DNA Ladder
Lane 2: Tube A - 0.3 ng pGBR-22 DNA
Lane 3: Tube B - 3.0 ng pGBR-22 DNA
Lane 4: Tube C - 30 ng pGBR-22 DNA
Lane 5: Tube D - no template pGBR-22 DNA
Lane 6: Empty
The results are as expected, so it can be confided that PCR on pGBR-22 was successful! The 100 bp ladder in Lane 1 looks strange (most likely because of the gel "smiling"), but the other lanes look great. The amount of template DNA in each tube was increased by a factor of ten each time (0.3 ng DNA in Tube A t0 3 ng DNA in Tube B to 30 ng DNA in Tube C), so it was expected that after PCR the gel would reveal an increasing concentration from Row 2 (Tube A) to Row 3 (Tube B) to Row 4 (Tube C). This is exactly what the gel shows. Additionally, Row 5 serves as a control because there was no template DNA added to Tube D. As expected, we see nothing in Row 5.
WEEKS 1 & 2
NanoDrop/DNA Sequencing
Figure 1: NanoDrop results from the pGBR-22 sample, showing the concentration of the protein to be 22.5 ng/uL. The absorbance peak is around 260nm, as is expected for a protein. However, the purity ratios (260/280 and 230/280) are both higher than they should be.
Figure 2: Forward sequence of the pGBR-22 sequence, as obtained from the DNA Sequencing Core at UT Austin. Order Number 106937. N's stand in place of amino acids whose identities were not able to be determined.
Figure 3: Reverse sequence of the pGBR-22 sequence, as obtained from the DNA Sequencing Core at UT Austin. Order Number 106937. N's stand in place of amino acids whose identities were not able to be determined.
Analyzing DNA Sequence Exercise
Figure 1: NCBI BLAST of the M13R Primer Sequence against the human genome looking for 'somewhat similar' sequences. The closest match to the primer sequence is part of the human X chromosome, which shares 97% identity but only 5% query cover with the M13R sequence.
Figure 2: NCBI BLAST of the M13R Primer Sequence against all genomes looking for 'somewhat similar' sequences. The closest match to the primer sequence is Montipora efflorescens GFP-like chromoprotein, which shares 100% identity and 60% query cover with the M13R sequence.
Figure 3: Complete sequence of pGBR-22. Obtained by taking the vector pGemT sequence, matching it up with the M13R sequence by identifying flanking regions, and inserting the corresponding part of the M13R sequence in between the left (highlighted grey) and right (highlighted pink) flanking regions. The start codon, ATG, is highlighted green. The Shine-Dalgarno region, AGGAGA, is highlighted cyan. The stop codon, TAA, is highlighted red. And, the part of the M13R sequence that was inserted is bolded and underlined.
Transformation of DH5-Alpha Cells
Figure 1: Agar plate with 10uL DH5-alpha cells with pNIC-Bsa4 plasmid after ~16 hours in the 37 degree Celsius incubator. No growth is evident.
As is obvious from the images above, the transformation did not work and there was no growth on the plates. This could be attributed to any one of many different errors. The DH5-alpha cells were not used within five minutes of being removed from the freezer - it is possible that they died and were no longer competent before the rest of the experiment was even started. If they did survive, they were also left on ice for an hour rather than thirty minutes because we forgot to heat the hot water bath beforehand and had to wait an additional thirty minutes for the water to warm up for the heat shock. Finally, after heat shocking and adding SOC media the cells remained in the shaking incubator for longer than thirty minutes because we had forgotten to warm up the agar plats in the incubator beforehand so had to wait for them to warm up before plating the bacteria. Regardless of where the mistake happened, the experiment will be repeated next week.
*UPDATE* I repeated the transformation process, but was silly and used the wrong plasmid. I used pGBR-22 instead of pNIC because we had been working so much with pGBR-22 that week that I got confused. I'm confident that in the future (if I remember to use the correct plasmid) my transformations will be successful because repeating the experiment made me very familiar with the protocol even though it didn't actually work.